Veterinary Diagnostic Laboratory
Iowa State University
College of Veterinary Medicine
Ames, Iowa 50011-1134

Phone: 515-294-1950
Fax: 515-294-3564
Accession: 2021100984

Final Report
Accessed Date: 10/20/2025 09:26 pm
DR DANIEL GASCHO
SWINE HEALTH CARE INC
4015 N MEXICO RD
MEXICO , IN 46958



Owner
Diagnostician
: M AND C HILL FAMILY FARMS
: GAUGER, PHILLIP
Site : M AND C HILL FAMILY FARMS
  6619 S 300 E
  WABASH , IN 46992
 
Premises ID# : 0046ZGH
 
Lot/Group ID :
Source/Flow ID :
Reference :
Case Tags :

Client Phone: 765-985-2344 Species: Porcine Age: 30 Weeks
Client Fax: 765-985-2316 Breed: Unknown Weight:
Client Account#: 000086001 Sex: Female Received: 5 Oral Fluids
Date Received: 11/17/2021 Previous Case:
Sample Taken: 11/16/2021 Farm Type: Other Reason: General Diagnostics
Accompanying Cases: Animal ID(s): See below
Final Report(s): 11/29/2021 12:41 pm, 11/29/2021 12:41 pm

PRRSV sequencing results are reported in the bioinformatics section below. Please note the RFLP, genetic lineage and any comments that have been included for this PRRSV sequence. Please contact the laboratory if you would like any further interpretation or have other sequences for comparison to this one. (11/22/21 pcg/ns)

 

SUPPLEMENTAL REPORT

The full-length sequence of the Influenza A Virus (IAV) HA gene and U.S. phylogenetic clade information is provided in the sequencing test report shown below. The IAV hemagglutinin (HA) H1 and H3 sequences and neuraminidase (NA) N1 and N2 sequences, if requested, are classified into phylogenetic clades using the publicly available HA identity tool on the ISU VDL website ISU FLUture (https://influenza.cvm.iastate.edu/). A sequence is assigned to a specific clade when a blast comparison is conclusive, designated with a “like” designation when a sequences classification is less certain, and designated not classified when a sequence does not cluster with a specific clade. Please correlate these results with clinical impressions and previous IAV sequences and contact the ISU VDL with questions or sequences comparison requests.

 

Common H1 clades circulating in swine include 1) alpha; 2) beta; 3) gamma; 4) pandemic; 5) delta1a; 6) delta 1b; 7) delta 2; 8) gamma2-beta-like (LAIV); 9) -like or not determined. The global swine H1 classification includes 1A classical swine lineage (1A.1, 1A.2, 1A.3, and their subclades), 1B human seasonal lineage (1B.1, 1B.2, and their subclades), and 1C Eurasian avian lineage (1C.1, 1C.2, and their subclades). The report includes both the U.S. swine H1 and global H1 lineages with the latter in parenthesis. Common H3 clades circulating in swine include 1) Cluster I (LAIV); 2) Cluster IV; 3) Cluster IVA; 4) Cluster IVB; 5) Cluster IVC; 6) Cluster IVD; 7) Cluster IVE; 8) Cluster IVF; 9) H3.2010.1; 10) H3.2010.2; 11) -like or not determined. There is no global H3 lineage designation published at this time. Clade lineages and descriptions are also available on ISU FLUture using the information link on the website. (11/23/21 pcg/mrs)

 

KEY: Tests: FA = Fluorescent Antibody, IHC = Immunohistochemistry, ISH = in situ hybridization, MALDI = Matrix-assisted laser desorption/ionization, MLV = Modified Live Virus, ORF = Open Reading Frame, PCR = Polymerase Chain Reaction, RFLP = Restriction Fragment Length Polymorphism, VI = Virus Isolation. Agents: BCV = Bovine Coronavirus, BHV = Bovine Herpesvirus, BRSV = Bovine Respiratory Syncytial Virus, BVDV = Bovine Viral Diarrhea Virus, CSF = Classical Swine Fever, GPS = Glaesserella (Haemophilus) parasuis, IAV = Influenza A Virus, MHP = Mycoplasma hyopneumoniae, MHR = Mycoplasma hyorhinis, MHS = Mycoplasma hyosynoviae, PCV = Porcine Circovirus, PDCV = Porcine Deltacoronavirus, PEDV = Porcine Epidemic Diarrhea Virus, PPV = Porcine Parvovirus, PRCV = Porcine Respiratory Coronavirus, PRRSV = Porcine Reproductive & Respiratory Syndrome Virus, PRV = Pseudorabies Virus, SVA = Senecavirus A, TGEV = Transmissible Gastroenteritis Virus

 



Test Ordered Order Date Current Status Complete Date
PCR - PRRSV Applied Biosystems 11/17/2021 Result(s) Released 11/17/2021
PCR - Influenza A 11/17/2021 Result(s) Released 11/17/2021
PCR - Influenza A subtype Applied Biosystems 11/17/2021 Result(s) Released 11/18/2021
PCR - PRRSV Zoetis Fostera-like 11/18/2021 Result(s) Released 11/18/2021
PCR - PEDV/PDCoV/TGEV Multiplex Applied Biosystems 11/17/2021 Result(s) Released 11/17/2021
PCR - Influenza HA gene 11/19/2021 Result(s) Released 11/23/2021
^Sequencing and Analysis - Influenza HA gene 11/19/2021 Result(s) Released 11/23/2021
PCR - PRRSV ORF5 Type 2 (NA) 11/19/2021 Result(s) Released 11/22/2021
^Sequencing and Analysis - PRRSV Type 2 (NA) 11/19/2021 Result(s) Released 11/22/2021
^ Testing performed in part or in total at a Referral Laboratory.


Molecular Diagnostic


PCR - PRRSV Applied Biosystems
Animal ID Specimen PRRSV-2 (NA) Ct/Result PRRSV-1 (EU) Ct/Result Comment
AW, Tube #1 Oral fluid 33.2 / Positive 31.4 / Positive
AW, Tube #2 Oral fluid 32.0 / Positive 30.3 / Positive
Gestation, Tube #3 Oral fluid 36.3 / Positive 34.6 / Positive
Gestation, Tube #4 Oral fluid >=37 / Negative 36.5 / Positive
Gestation, Tube #5 Oral fluid >=37 / Negative >=37 / Negative
PCR - Influenza A
Animal ID Specimen Target Ct / Result Comment
AW, Tube #1 Oral fluid Influenza general 20.9 / Positive
AW, Tube #2 Oral fluid Influenza general 22.6 / Positive
Gestation, Tube #3 Oral fluid Influenza general >=38 / Negative
Gestation, Tube #4 Oral fluid Influenza general >=38 / Negative
Gestation, Tube #5 Oral fluid Influenza general >=38 / Negative
PCR - Influenza A subtype Applied Biosystems
Animal ID Specimen Target Ct / Result Comment
AW, Tube #1 Oral fluid Influenza H121.7 / Positive
Influenza H3>=40 / Negative
Influenza N122.0 / Positive
Influenza N2>=40 / Negative
PCR - Influenza A subtype Applied Biosystems
Animal ID Specimen Target Ct / Result Comment
AW, Tube #2 Oral fluid Influenza H123.7 / Positive
Influenza H3>=40 / Negative
Influenza N124.3 / Positive
Influenza N2>=40 / Negative
PCR - PRRSV Zoetis Fostera-like
Samples were tested with a PCR assay that specifically targets PRRSV MLV vaccine-like strains. Samples testing positive suggest the presence of vaccine-like virus but does not exclude a potential co-infection with a wild-type PRRSV. The ISU VDL reports PRRSV ORF5 as likefor sequences <>98% identical to reported vaccine sequences. However, vaccine-specific PCR assays may detect some ORF5 96% < 98% as In that case or for discrepancies between the PCR and ORF5 sequencing, whole genome sequencing is recommended. This assay should only be used after an initial PRRSV screening PCR has been completed and samples with Ct values >32 may be reported falsely as negative using vaccine-like PCR due to low quantities of virus in the sample. Please call if there are questions.
Animal ID Specimen Ct / Result Comment
AW, Tube #1 Oral fluid >=40 / Negative
AW, Tube #2 Oral fluid >=40 / Negative
Gestation, Tube #3 Oral fluid >=40 / Negative
Gestation, Tube #4 Oral fluid >=40 / Negative
PCR - PEDV/PDCoV/TGEV Multiplex Applied Biosystems
Animal ID Specimen PEDV / Result PDCoV / Result TGEV / Result Comment
AW, Tube #1 Oral fluid >=36 / Negative >=36 / Negative >=36 / Negative
AW, Tube #2 Oral fluid >=36 / Negative >=36 / Negative >=36 / Negative
Gestation, Tube #3 Oral fluid >=36 / Negative >=36 / Negative >=36 / Negative
Gestation, Tube #4 Oral fluid >=36 / Negative >=36 / Negative >=36 / Negative
Gestation, Tube #5 Oral fluid >=36 / Negative >=36 / Negative >=36 / Negative


Bioinformatics


PCR - Influenza HA gene
Animal ID Specimen Result Comment
AW, Tube #1 Oral fluid Positive
Sequencing and Analysis - Influenza HA gene
The full-length sequence of the Influenza A Virus (IAV) HA gene and U.S. phylogenetic clade information is provided in the sequencing test report shown below. The IAV hemagglutinin (HA) H1 and H3 sequences and neuraminidase (NA) N1 and N2 sequences, if requested, are classified into phylogenetic clades using the publicly available HA identity tool on the ISU VDL website ISU FLUture (https://influenza.cvm.iastate.edu/). Please correlate these results with clinical impressions and previous IAV sequences and contact the ISU VDL with questions or sequences comparison requests.
Animal ID Specimen Target Gene
AW, Tube #1 Oral fluid HA
US Clade Global Clade Comment
H1 pandemic 1A.3.3.2
Nucleotide
ATGAAAGCAATACTAGTAGTTATGCTATATACATTTACAACCGCAAATGCAGACACATTATGTATAGGTTATCATGCGAA CAATTCAACAGACACTGTGGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGTCAATCTTCTGGAAGACAAGC ATAACGGAAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGA AATCCAGAGTGTGAATCACTCTCCACAGCAAGATCATGGTCCTACATTGTGGAAACATCTAATTCAGACAATGGAACGTG TTACCCAGGAGATTTCATCAATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTAAAAGGTTTGAAATAT TCCCCAAGGCAAGTTCATGGCCTAATCATGAATCGGACAAGGGTGTAACGGCAGCATGTCCTCACGCTGGAGCAAAAAGC TTCTACAAAAACTTGATATGGCTGATTAAAAAAGGAAACTCATACCCAAAGATCAACCAAACCTACATTAATGATAAAGG GAAAGAAGTCCTCGTGCTGTGGGGCATTCACCATCCACCTACTATTGCTGACCAACAAAGCCTCTATCAGAATGCAGATG CATATGTTTTTGTGGGGACATCAAGATACAGCAAGAAGTTCAGGCCGGAAATAGCAACAAGACCCAAAGTGAGGGATCAA GAAGGGAGAATGAACTATTACTGGACACTAGTAGAACCGGGAGACAAAATAACATTCGAAGCAACTGGTAATCTAGTGGC ACCGAGATATGCATTCACAGTGGAAAGAGATGCTGGATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATA CAACTTGTCAGACACCCGAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATGTACATCCGATTACGATTGGGAAATGT CCAAAGTATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCTATT CGGGGCCATTGCTGGCTTCATCGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGC AGGGGTCAGGATATGCAGCCGATCTGAAGAGCACGCAAAATGCCATTGATAAGATTACTAACAAAGTAAATTCTGTTATT GAAAAGATGAATACACAGTTCACAGCAGTTGGTAAAGAGTTCAACCACCTCGAAAAAAGAATAGAGAATCTAAATAAAAA GGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCTGAACTGTTGGTTCTACTGGAAAACGAAAGGACTTTGGACT ATCACGATTCAAATGTGAAGAACTTGTATGAAAAAGTAAGAAACCAGTTAAAAAACAATGCCAAGGAAATTGGAAACGGC TGTTTTGAATTTTACCACAAATGCGACAACACATGCATGGAAAGTGTCAAGAATGGGTCTTATGACTACCCAAAATACTC AGAGGAAGCAAAATTGAACAGAGAAAAAATAGATGGAGTAAAGCTGGACTCAACAAGGATCTACCAGATTTTGGCGATCT ATTCAACTGTTGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGCTTCTGGATGTGCTCTAATGGGTCTCTA CAGTGTAGAATATGTATTTAA
PCR - PRRSV ORF5 Type 2 (NA)
Animal ID Specimen Result Comment
AW, Tube #2 Oral fluid Positive
Sequencing and Analysis - PRRSV Type 2 (NA)
Please note the RFLP, genetic lineage and any comments that have been included for this PRRSV sequence. Please contact the laboratory if you would like any further interpretation or have other sequences for comparison to this one.
Animal ID Specimen Target Gene RFLP Lineage
AW, Tube #2 Oral fluid ORF5 1-7-4 1A
Comment : Wild type
Sequence Homology
Reference Virus Ingelvac ATP PRRSGard Prime Pac
Percent Identity87.3 %88.7 %87.2 %
Reference Virus Ingelvac MLV Fostera Prevacent
Percent Identity87.2 %87.9 %87.6 %
Nucleotide
ATGTTGGAGAAATGCTTGACCGCGGGCTGCTGCTCGCAATTGCCTTTTTTGTGGTGTATCGTGCCGTTTTGTTTTGTTGC GCTCGTCAACGCCAACAACAGCAACAGCTCCCATTTACAGTTGATTTATAACCTGACGATATGTGAGCTGAATGGCACAG ATTGGCTAAATAAAAGTTTTGATTGGGCGGTGGAGACTTTTGTCATCTTTCCTGTGTTGACTCATATTGTCTCCTATGGC GCCCTCACCACCAGTCATTTCCTTGACACAGTTGGTCTGATCACCGTGTCTGCCGCCGGATATTACCACGGGCGGTATGT CTTGAGTAGCATTTACGCCGTCTGCGCCCTGGCTGCGTTGACGTGCTTCGTCATCAGGCTAACAAAAAATTGCATGTCCT GGCGCTACTCATGCACCAGATACACTAATTTCCTTCTGGATACCAAGGGCAAACTCTATCGTTGGCGGTCTCCTGTCATC ATAGAAAAGGGGGGTAAAATTGAGGTCGAAGGTCACCTGATCGACCTCAAGAGAGTTGTGCTTGACGGTTCCGCGGCAAC CCCTGTAACCAAAGTTTCGGCGGAACAATGGGGTCGTCTTTAG

Animal ID Information
SID # Animal ID Age Gender Weight Location Parity
1 AW 30 Weeks Female
2 AW 30 Weeks Female
3 Gestation 40 Weeks Female
4 Gestation 40 Weeks Female
5 Gestation 40 Weeks Female
594